View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_low_43 (Length: 252)
Name: NF17083_low_43
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 6449521 - 6449745
Alignment:
| Q |
18 |
aatttaagtgcctatttagcttaataggaagnnnnnnntcaagaagctagagggtgaacctaatttcaatcacttcttgatttgattgagttctattttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6449521 |
aatttaagtgcctatttagcttaataggaaaaaaaaaatcaagaagctagagagtgaacctaatttcaatcacttcttgatttgattgagttctattttc |
6449620 |
T |
|
| Q |
118 |
ctctttctttctccttttcagcctgtcttctacctatgtgttttattgagttctattcttgccttctataacttttgtttctcaacatctcttcccccta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6449621 |
ctctttctttctccttttcagcctgtcttctacctatgtgttttattgagttctattcttgccttcaataacttttgtttctcaacatctcttcccccta |
6449720 |
T |
|
| Q |
218 |
agtgttattgttattgatgcctttg |
242 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
6449721 |
agtgttattgttattgttgcctttg |
6449745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University