View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_low_44 (Length: 250)
Name: NF17083_low_44
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 36021716 - 36021533
Alignment:
| Q |
1 |
ctttttatcctaccagccaaatcataaattattttttaaaattagatatgataaaagtcaaagtcttttaatgatcgaaagaaatataattggttgacag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
36021716 |
ctttttatcctagcagccaaatcataaattattttttaaaattagatatgataagagtcaaagtcttttaatgatcgaaag-aatataattggttgaccg |
36021618 |
T |
|
| Q |
101 |
tataattgttttacaatattttgaacgtaacaatttannnnnnnatgcaggaaataactaatataatatcaggatcatatgagtc |
185 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36021617 |
tgtaattgttttacaatattttgaacgtaacgatttatttttttatgcaggaaataactaatataatctcaggatcatatgagtc |
36021533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 36021537 - 36021498
Alignment:
| Q |
197 |
gagtcttgtataagaaaacaaataaaccgcaaaaaatagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36021537 |
gagtcttgtataagaaaacaaataaaccgcaaaaaatagt |
36021498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University