View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_low_49 (Length: 237)
Name: NF17083_low_49
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36021884 - 36022102
Alignment:
| Q |
1 |
agtttgaagttgaaaaagagatttttcgtgtttgaagtcttaagcaaggttgccggataaagaacgtaagaaaaaattgttggcaatagcaaataaatag |
100 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36021884 |
agtttgaagttgaaagatagatttttcgtgtttgaagtcttaagcaaggttgccggataaagaacgtaagaaaaaattgttggcaatagcaaataaatag |
36021983 |
T |
|
| Q |
101 |
aaattattgaggcaagaatggattgtgagttgagagtctaaaatgattcagttagggagttgagtttagaaaggattcagttacggaatccgtctgttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36021984 |
aaattattgaggcaagaatggattgtgagtt--gagtctaaaatgattcagttagggagttgagtttagaaaggtttcagttacggaatccgtctgttat |
36022081 |
T |
|
| Q |
201 |
tttcatattctaggtaatgag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36022082 |
tttcatattctaggtaatgag |
36022102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University