View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_low_53 (Length: 235)
Name: NF17083_low_53
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 33556405 - 33556598
Alignment:
| Q |
17 |
aatatgtccttaaaatcttgatcatagattatttgatgaattgaagatgaagagaatatactaacactttgcaacttttgatattaagctttaagaatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33556405 |
aatatgtccttaaaatcttgatcatagattatttgatgaattgaagatgaagagaatatactaacactttgcaacttttgatattaagctttaagaatct |
33556504 |
T |
 |
| Q |
117 |
caaatttttagggttaggatgaagtgttaaaatttaattgtgaaatgtctagagtcatgatgcctttgtttatcacataaatttcttagtataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33556505 |
caaatttttagggttaggatgaagtgttaaaatttaattgtgaaatgtctagagtcatgatgcctttgtttatcacataaatttcttagtataa |
33556598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University