View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17084_high_17 (Length: 300)
Name: NF17084_high_17
Description: NF17084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17084_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 5798955 - 5799225
Alignment:
| Q |
13 |
aatattgacagagaaaccaacaaactaaaactcccaaccttcttaacaaaaaagagagagggttgagatcattaagggatagcatatgctataggtgctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5798955 |
aatattgacagagaaaccaacaaactaaaactcccaaccttcttaacaaaaaagagagagggttgagatcattaagggatagcatatgctataggtgctt |
5799054 |
T |
 |
| Q |
113 |
ttgttttgttttgtatggtgattcttttgccccctcctcccatgtacctataccagtcttagtgttaggagtattggtattggtgtttgaatgaaagaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799055 |
ttgttttgttttgtatggtgattcttttgccctcttctcccatgtacctataccagtcttagtgttaggagtattggtattggtgtttgaatgaaagaat |
5799154 |
T |
 |
| Q |
213 |
aggcaaactgcagagcaatcatcaggcttagatggaaccttagtcttccatgcttgaacagctgcctcaac |
283 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5799155 |
aggcaaactgcagagcaatcatcaggtttagatggaatcttagtcttccatgcttgaacagctgcctcaac |
5799225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University