View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17084_low_16 (Length: 336)
Name: NF17084_low_16
Description: NF17084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17084_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 11 - 321
Target Start/End: Original strand, 25035504 - 25035798
Alignment:
| Q |
11 |
cataggcatataaataatctattgtagcagctgcaaattatttttgtcttatgtattttcataggaagaaaattctatgcgaacctacgatgcaagggta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25035504 |
cataggcatataaataatctattgtagcagctgcaaattatttttgtcttatgtattttcataggaagaaaattctatgcgaacctacgatgcaagggta |
25035603 |
T |
|
| Q |
111 |
aatgccctaggtcgatccactaattacagatggatcattaaggatattaaggtttagtttataatattaatttcatctctatgattatatttcttttctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25035604 |
aatgccctaggtcgatccactaattacaggtggatcattaaggatattaaggtttagtttataatattaattccatctctatgattatatttcttttctt |
25035703 |
T |
|
| Q |
211 |
tcaatccttagtcttgcaatttcgatttctgattattggttaacctgattattggttaacgattgaatttggttgttgcttttatctaaattaaagtaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25035704 |
tcaatccttagtcttgcaatttcgatttctg----------------attattggttaacgattgaatttcgttgttgcttttatctaaattaaagtaat |
25035787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 254
Target Start/End: Original strand, 22656423 - 22656532
Alignment:
| Q |
145 |
tcattaaggatattaaggtttagtttataatattaatttcatctctatgattatatttcttttctttcaatccttagtcttgcaatttcgatttctgatt |
244 |
Q |
| |
|
|||| ||||||||| |||||| |||| ||||| ||||| | | ||||||| ||||||||||||||||| |||| ||| ||||||||| |||||||||| |
|
|
| T |
22656423 |
tcatcaaggatattgaggtttggtttgcaatatcaattttgtttttatgattctatttcttttctttcaaaccttcgtcgtgcaatttcaatttctgatt |
22656522 |
T |
|
| Q |
245 |
attggttaac |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
22656523 |
gttggttaac |
22656532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 239
Target Start/End: Complemental strand, 16607482 - 16607445
Alignment:
| Q |
202 |
tcttttctttcaatccttagtcttgcaatttcgatttc |
239 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16607482 |
tcttttctttcaaaccttagtcttgcaatttcaatttc |
16607445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University