View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17084_low_21 (Length: 300)
Name: NF17084_low_21
Description: NF17084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17084_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 11 - 205
Target Start/End: Complemental strand, 30500663 - 30500478
Alignment:
| Q |
11 |
cacggaaaattgatgaaaatttgttgctctcttgtgttttgttttgtgtattttagtaatccgtaaaattgataaaaaggtgagaaaataaagatagagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30500663 |
cacggaaaattgatgaaaatttgttgttctcttgttttttgtt--gtgtattttagtaatccgtaaaattgataaaaagttgagaaaataaagatagagt |
30500566 |
T |
|
| Q |
111 |
tataacttatagggtgccatttaattaattgtattgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
205 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500565 |
tata-------gggtgccatttaattaattttattgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
30500478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 286
Target Start/End: Complemental strand, 30500435 - 30500389
Alignment:
| Q |
240 |
aaaactcaatacttacctttatgcctcgtattttcttgggtaatcct |
286 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500435 |
aaaacccaatacttacctttatgcctcgtattttcttgggtaatcct |
30500389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University