View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17084_low_27 (Length: 256)
Name: NF17084_low_27
Description: NF17084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17084_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 26211159 - 26210922
Alignment:
| Q |
1 |
cgcatgtcgccgtctcacactctcacgctctccttcctccaaccgcatatccttcgctgttgcaccaaaccacaccgtccatgacacgttcaacaaccac |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211159 |
cgcatgccgccgtctcacactctcacgctctccttcctccaaccgcatatccttcgctgttgcaccaaaccacaccgtccatgacacgttcaacaaccac |
26211060 |
T |
 |
| Q |
101 |
cgtctctcatggacacaccatgtagacaccatgcaggattctgtagaagaaaaacgcagcttcactctccgttttccgaagcgtcaccgtcacgcgcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26211059 |
cgtctctcatggacacaccatgtagacaccatgcaggattctgtagaagaaaaacgcagcttcacgctccgttttccgaagcgtcaccgtcacgcgcttc |
26210960 |
T |
 |
| Q |
201 |
tctctgcgtatctctctcatgtcacctcacgcgccgag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210959 |
tctctgcgtatctctctcatgtcacctcacgcgccgag |
26210922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University