View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17084_low_28 (Length: 252)
Name: NF17084_low_28
Description: NF17084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17084_low_28 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 762668 - 762911
Alignment:
| Q |
7 |
tagataatactaacggtttagattattgtttttattagaaatatggtgtgttcctccatcgataacggcttacatcaagtctttatcttacccnnnnnnn |
106 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
762668 |
tagattataataacggtttagattattgtttttattagaaatatggtgtgttcctccatcgataacggcttacatcaagtctttat--tacccttttttt |
762765 |
T |
 |
| Q |
107 |
gcttccttcctctatcgacaatccttaacatttataatttaattttattgcacaacatcatcaattcataaacttggttccgttgctaaggtttacagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
762766 |
gcttccttcttctatcgacaatccttaacatttataatttaattttattgcacaacatcatcaattcataaacttgtttccgttgctaaggtttacagtg |
762865 |
T |
 |
| Q |
207 |
acagcggctacagccctaataccgaagaatataagtgattgaagaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
762866 |
acagcggctacagccctaataccgaagcatataagtgattgaagaa |
762911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 9599163 - 9599346
Alignment:
| Q |
24 |
ttagattattgtttttattagaaatatggtgtgttcctccatcgataacggctta-----------catcaagtctttatcttacccnnnnnnngcttcc |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |||| ||||||| |||| ||| || ||| |
|
|
| T |
9599163 |
ttagattaatgtttttattagaaatatggtgggttcctccatctataacggcttaacaacaacttacatcgagtctttctcttgccctttttttgcctcc |
9599262 |
T |
 |
| Q |
113 |
ttcctctatcgacaatccttaacatttataatttaattttattgcacaacatcatcaattcataaacttggttccgttgctaag |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||| ||||||||| |
|
|
| T |
9599263 |
ttcctctatcgacaattcttaacatttataatttaattttattgcacaacattatccattcataaacttgtttctgttgctaag |
9599346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 244
Target Start/End: Original strand, 5364948 - 5365046
Alignment:
| Q |
146 |
taattttattgcacaacatcatcaattcataaacttggttccgttgctaaggtttacagtgacagcggctacagccctaataccgaagaatataagtga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||| | || || ||||| |||||||| || | | ||||||| ||| |||||| |
|
|
| T |
5364948 |
taattttattgcacaacatcatcaattcataaacttgttttcgttgctatgtttaacggtgacgccggctacaaccttgagaccgaagcatagaagtga |
5365046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University