View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_high_59 (Length: 247)
Name: NF17087_high_59
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_high_59 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 6295225 - 6294995
Alignment:
| Q |
16 |
ttacttacgtacaataatgtggttgtaacctttatttgaattgctgacttatgtctattgctataatgcaatggtcttaaatcttaattactaagtatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6295225 |
ttacttacgtacaataatgtggttataacctttatttgaattgctgacttatgtctattgctataatgcaatggtcttaaatcttaattactaagtatgt |
6295126 |
T |
 |
| Q |
116 |
atgaatgtcatggatattggttaatggatcttatctataggtgtgtaactgctattgatgggtttctgacatggaagagatgttcgctggcaagctaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6295125 |
atgaatgtcatggatattggttaatggatcttatctataggtgtgtaactgctattgatgggtttctgacatggaagagatgttcgctggcaagctaagg |
6295026 |
T |
 |
| Q |
216 |
agtagttgagtgaaaatttataatgtgaatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6295025 |
agtagttgagtgaaaatttataatgtgaatg |
6294995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 35 - 246
Target Start/End: Complemental strand, 6281735 - 6281512
Alignment:
| Q |
35 |
tggttgtaacctttatttgaattgctgacttatgtctattgctataatgcaatggtcttaaatcttaattactaagtatgtatgaatgtcatggat---- |
130 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||| |||||| |
|
|
| T |
6281735 |
tggttataaactttatttgaattgctgacttatgtctattgctataatggaatggtcttaaatcttaattaataagtctgtataaatgttatggattggt |
6281636 |
T |
 |
| Q |
131 |
--attggtt-aatggatcttatctataggtgtgtaactgctattgatgg-----gtttctgacatggaagagatgttcgctggcaagctaaggagtagtt |
222 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| ||||||||| || ||||| ||| |
|
|
| T |
6281635 |
tcattggttgattggatcttatctataggtgtgtaactgctattgatgggttgcgttgctgacatggaagaggtgttggctggcaaggtacggagtcgtt |
6281536 |
T |
 |
| Q |
223 |
gagtgaaaatttataatgtgaatg |
246 |
Q |
| |
|
||||| |||||||||| ||||||| |
|
|
| T |
6281535 |
gagtggaaatttataaagtgaatg |
6281512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 235
Target Start/End: Original strand, 451579 - 451678
Alignment:
| Q |
140 |
tggatcttatctataggtgtgtaactgctattgatgg----gtttctgacatggaagagatgttcgctggcaagctaaggagtagttgagtgaaaattta |
235 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| | ||| |||||||||||||| |||| | ||||||| || |||||||||||||||||||| |
|
|
| T |
451579 |
tggatcttatatataggtgtctaactgctattgattgataggttgctgacatggaagaggtgtttgttggcaaggtaccaagtagttgagtgaaaattta |
451678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University