View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_high_63 (Length: 241)
Name: NF17087_high_63
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_high_63 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 29 - 241
Target Start/End: Original strand, 21270828 - 21271040
Alignment:
| Q |
29 |
attatgcaacaaataatcgactagggattcattccctctttggtaaaagatcttattttgcaactaatataagcacttataaacaagctaattccatgaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21270828 |
attatgcaacaaataatcgactagggattcattccctctttggtaaaagatcttattttgcaactaatataagcacttataaacaagctaattccatgaa |
21270927 |
T |
 |
| Q |
129 |
cataaaacacagcaaaaacaaagccaaacttttatcttatttaacactctatgagttgatttgatacactgtcgtgtggatcttactgttaacaagttga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21270928 |
cataaaacacagcaaaaacaaagccaaacttttatcttatttaacactctataagttgatttgatacactgtcgtgtggatcttactgttaacaagttga |
21271027 |
T |
 |
| Q |
229 |
aactaagctgttt |
241 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
21271028 |
aactaagttgttt |
21271040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University