View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_37 (Length: 318)
Name: NF17087_low_37
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 43792248 - 43792526
Alignment:
| Q |
19 |
ttgaatatgttggaaaaacacaacaaagggggatttgaattatgttaatcattttaaaatctcttcgcaaagacatgtgtttagttaaaccatagttgtt |
118 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43792248 |
ttgaatatgttggaaaaacacgacaaaaggggatttgaattatgttaatcattttaaaatcttttcgcaaagacatgtgtttagttaaaccatagtcgtt |
43792347 |
T |
 |
| Q |
119 |
cttcaaattaattttaacaaacacgttagttctttgtcaaatcatttaactccatgtgcaatgcttagctaaaaaggtgaagttaaatcacaaagaagca |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43792348 |
tttcaaattaattttaacaaccacgttagttcttattcaaatcatttaactccatgtgcaatgcttagataaaaaggtgaagttaaatcacaaagaagca |
43792447 |
T |
 |
| Q |
219 |
ctgcttagtaagtaagttaaagaataaaagagagtaagagaaatgagatgacacaatatgtttatactagttaatcatccaac |
301 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43792448 |
ctgcttagtaagttttt----gaataaaagagagtaagagaaatgagatgacacaatatgtatatactagttaatcatccaac |
43792526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University