View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_38 (Length: 315)
Name: NF17087_low_38
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 38662176 - 38661889
Alignment:
| Q |
20 |
ataaaatacaataaaaataacattagnnnnnnngttttgtttgaaataacattaaatcatgtaccattacaacaatatataaagtataaagctcattaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38662176 |
ataaaatacaataaaaataacattagattttttgttttgtttgaaataacattaaatcatgtaccattacaacaatatataaagtataaagcttattaat |
38662077 |
T |
|
| Q |
120 |
tgaaaatttggattgtac---------------------acatctagatcgtttgatcaagataaaatattccagatttcaacgcagattctttgaaatc |
198 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38662076 |
tgaaaatttggattctacgtggtgtgagtgcagtcaaccacatctagatcgtttgatcaagatcaaatattccagatttcaacgcatattctttgaaatc |
38661977 |
T |
|
| Q |
199 |
taaaatattgagcttgactgcatgcggccacgggattgtgaccgcactcaactcgtatccatactattaaatgtaacttttcatgaag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38661976 |
taaaatattgagcttgactgcatgcggccacggggttgtgaccgcactcaactcatatccatactattaaatgtaacttttcatgaag |
38661889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University