View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_46 (Length: 285)
Name: NF17087_low_46
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 20 - 278
Target Start/End: Original strand, 43672477 - 43672735
Alignment:
| Q |
20 |
atagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctggtttataatgatgagaatgaca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43672477 |
atagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctagtttataatgatgagaatgaca |
43672576 |
T |
 |
| Q |
120 |
cgtggcgtgatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagttt |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672577 |
cgtggcgtaatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagttt |
43672676 |
T |
 |
| Q |
220 |
ggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672677 |
ggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc |
43672735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University