View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_47 (Length: 282)
Name: NF17087_low_47
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 110 - 267
Target Start/End: Complemental strand, 29114092 - 29113935
Alignment:
| Q |
110 |
ggggttggatttaatctaactaatctaattgactgggattaaatattggtatcatttcattagtaaacttgtgtgcagtgcagacctagaaggcgatttg |
209 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
29114092 |
ggggttggatttaatctaactgatccaattcactgggattaaatattggtatcatttcattagtaaacttgtgtgcagtgcaggcctagaaggagatttg |
29113993 |
T |
 |
| Q |
210 |
tttatcataccacatgattcttttatcttcttattttaaaggtttgaatttttaaatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29113992 |
tttatcataccacatgattcttttatcttcttattttaaaggtttgaatttttaaatt |
29113935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 13 - 121
Target Start/End: Complemental strand, 29114337 - 29114229
Alignment:
| Q |
13 |
aaaatcgggggcttggaggtgaccttgaccatttattatctatattgtttggtttgaaatgggtttaaactttaacccaaacaagaaaacaaaaaagggg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29114337 |
aaaatcgggggcttggaggtgaccttgaccatttatgatctatattgtttggtttgaaatgggtttaaactttaacccaaacaagaaaacaaaaaaggcg |
29114238 |
T |
 |
| Q |
113 |
gttggattt |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
29114237 |
gttggattt |
29114229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University