View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_54 (Length: 268)
Name: NF17087_low_54
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 23105463 - 23105701
Alignment:
| Q |
13 |
aatatttcttcattatgtctaaacctttcattttctttgtcactgtaatgtttttactattataaattttctcacatctttgatcttttaatttccgtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23105463 |
aatatttcttcattatgtctaaacctttcattttctttgtcactgtaatgtttttactattataaattttctcacatctttgatcttttaatttccgtga |
23105562 |
T |
|
| Q |
113 |
tatgcttacaagagtgttaaatatattataaaattggtgttatatttggttgtttgtgaatagcatggagatatttaatgataaattttacttatatcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23105563 |
tatgcttacaagagtgttaaatatattataaaattggtgttatatttggttgtttgtgaatagcatggagatatttaatgataaattttacttatatcat |
23105662 |
T |
|
| Q |
213 |
ctnnnnnnnncttagaattgaggtttatatccattatatc |
252 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||| |
|
|
| T |
23105663 |
ct-aaaaaaacttagaattaaggtttatatccattatatc |
23105701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University