View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_59 (Length: 248)
Name: NF17087_low_59
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 105 - 233
Target Start/End: Complemental strand, 39960072 - 39959944
Alignment:
| Q |
105 |
ctttaggaatttgggtgaactttattgtgtttctttagtgggaagtgtgattttagaaaaaatagagctgtttttggagtgtttttgacagaaagggagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39960072 |
ctttaggaatttgggtgaactttattgtgtttctttagtgggaagtgtgattttagaaaaaatagagctgtttttggagtgtttttgagagaaagggagt |
39959973 |
T |
 |
| Q |
205 |
caatttcaactaccaacgaatgagaatga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39959972 |
caatttcaactaccaacgaatgagaatga |
39959944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University