View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17087_low_59 (Length: 248)

Name: NF17087_low_59
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17087_low_59
NF17087_low_59
[»] chr8 (1 HSPs)
chr8 (105-233)||(39959944-39960072)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 105 - 233
Target Start/End: Complemental strand, 39960072 - 39959944
Alignment:
105 ctttaggaatttgggtgaactttattgtgtttctttagtgggaagtgtgattttagaaaaaatagagctgtttttggagtgtttttgacagaaagggagt 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39960072 ctttaggaatttgggtgaactttattgtgtttctttagtgggaagtgtgattttagaaaaaatagagctgtttttggagtgtttttgagagaaagggagt 39959973  T
205 caatttcaactaccaacgaatgagaatga 233  Q
    |||||||||||||||||||||||||||||    
39959972 caatttcaactaccaacgaatgagaatga 39959944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University