View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_63 (Length: 241)
Name: NF17087_low_63
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 11856888 - 11856833
Alignment:
| Q |
140 |
aaaaatttaacaccctatcactaagaaattttcagtttatgaaaacagttctctac |
195 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11856888 |
aaaattttaacaccctatctctaagaaattttcagtttatgaaaacagctctctac |
11856833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 11856939 - 11856887
Alignment:
| Q |
26 |
ctaattgaatattattggatgctttggatctcctttagtgaaaacagcacgaa |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | ||||||| ||||||| |
|
|
| T |
11856939 |
ctaattgaatattattggatgttttggatctcctatggtgaaaattgcacgaa |
11856887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University