View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_65 (Length: 238)
Name: NF17087_low_65
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3965427 - 3965207
Alignment:
| Q |
1 |
tagcaattgttttcttttttaaatccttaacaattgttagcatgacccattttataataatgcacaaagagaaaaagatgcaatattaatatttactaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3965427 |
tagcaattgttttcttttttaaatccttaacaattgttagcatgacccattttataataatgcacaaagagaaaaagatgtaatattaatatttactaga |
3965328 |
T |
|
| Q |
101 |
aatggtaagtgttcacttttgaacatcttttagaggtcgttagttgatagaagnnnnnnnncacttcaatcaagatcatcccatgagttgtctcttgcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3965327 |
aatggtaagtgttcacttttgaacatcttttagaggtcgttagttgatagaagaaaaaaaacacttcaatcaagatcatcccatgagttgtctcttgcta |
3965228 |
T |
|
| Q |
201 |
gggcttagttattagaaagag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3965227 |
gggcttagttattagaaagag |
3965207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 33
Target Start/End: Original strand, 3775426 - 3775455
Alignment:
| Q |
4 |
caattgttttcttttttaaatccttaacaa |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3775426 |
caattgttttcttttttaaatccttaacaa |
3775455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University