View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_66 (Length: 237)
Name: NF17087_low_66
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 3932539 - 3932725
Alignment:
| Q |
1 |
gaaataatttctatttgttttgttttgttgtgacaaaagattacatacaattattgtgtttgaaagacttgttaatatttaaaagtcacttcttactttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3932539 |
gaaataatttctatttgttttgttttgttgtgacaaaagattacatacaattattgtgtttgaaagacttgttaatattt-aaagtcacttcttactttt |
3932637 |
T |
 |
| Q |
101 |
gcaaaagtgt--------------ttataccccatgcaaacggcgaggaaagtaagagattaagggggaaaatataatcgataatata |
174 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3932638 |
gcaaaagtgtttatcccagtattattataccccatgcaaacggcgaggaaagtaagagattgagggggaaaatataatcgataatata |
3932725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 171 - 221
Target Start/End: Original strand, 3933065 - 3933115
Alignment:
| Q |
171 |
tataatgaagagacaaaccaataaaattgtacatagctttagatatgatag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3933065 |
tataatgaagagacaaaccaataaaattgtacatagctttagatatgatag |
3933115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University