View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_75 (Length: 212)
Name: NF17087_low_75
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_75 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 194
Target Start/End: Original strand, 47808322 - 47808501
Alignment:
| Q |
15 |
caaaggaacagttagatatctactaaattgttcatagtgtcaaggaatgtattcaagttagatagtagttgctcatattcagtttctgtaacaaacataa |
114 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47808322 |
caaaggaacaatcagatatctactaaattgttcatagcgtcaaggaatgtattcaagttagatagtagttgctcatattcagtttctgtaacaaacataa |
47808421 |
T |
 |
| Q |
115 |
aaatatttgaaacaaactctagagtaaagatagcaacactataaatagctggccttcccagcaagtttgatcacccaatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47808422 |
aaatatttgaaacaaactctagagtaaagatagcaacactataaatagctggccttcccagcaagtttgatcacccaatt |
47808501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University