View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17087_low_76 (Length: 208)
Name: NF17087_low_76
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17087_low_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 7571510 - 7571326
Alignment:
| Q |
21 |
aggatgaaaaaagcatggaaaatgttgatgtagcacttgctacctgcagtagagaacaaatttgg-------------attttgatttaactcaacccct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7571510 |
aggatgaaaaaagcatggaaaatgttgatgtagcacttgctacctgcagtagagaacaaatttggtattagaatttggattttgatttaactcaacccca |
7571411 |
T |
 |
| Q |
108 |
aaagctagagctctgtgaggtgataattatcctttataaattttaaaagttttgagataaaagtttaaatataccatgaaaattg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7571410 |
aaagctagagctctgtgaggtgataattatcctttataaattttaaaagttttgagataaaagtttaaatatacgatgaaaattg |
7571326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 7581731 - 7581674
Alignment:
| Q |
21 |
aggatgaaaaaagcatggaaaatgttgatgtagcacttgctacctgcagtagagaaca |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7581731 |
aggatgaaaaaagcatggaaaatgttgatgtagcacttgctacctgcagcagagaaca |
7581674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 141 - 180
Target Start/End: Original strand, 36028659 - 36028698
Alignment:
| Q |
141 |
ttataaattttaaaagttttgagataaaagtttaaatata |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
36028659 |
ttataaattttaaaagttttgagatacaagtataaatata |
36028698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University