View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17087_low_80 (Length: 201)

Name: NF17087_low_80
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17087_low_80
NF17087_low_80
[»] chr8 (1 HSPs)
chr8 (1-185)||(38117248-38117432)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 38117248 - 38117432
Alignment:
1 aggagtatatggaatgattcgtgtggcacctaatgaccctgaacctttttcttatgactttgatagaagcattattttgaatgattggtaccatgagagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||    
38117248 aggagtatatggaatgattcgtgtggcacctaatgaccctgaacctttttcttatgactttgatagaagcattattttgaatgattggtaccataggagt 38117347  T
101 acttatgaacaatctgctggattgtctgcaatcccttttcaatgggtgggggaaccagatgtaagaattagatggatatactaat 185  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38117348 acttatgaacaatctgctagattgtctgcaatcccttttcaatgggtgggggaaccagatgtaagaattagatggatatactaat 38117432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University