View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17088_low_6 (Length: 265)
Name: NF17088_low_6
Description: NF17088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17088_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 144 - 251
Target Start/End: Original strand, 44729349 - 44729456
Alignment:
| Q |
144 |
gaatatgagtgcgtcctgaggatcttgagtttgaactcagaagtaaagcttgcaaagcgaagttatgcaatgaagcctgttccctttgcttgatgtcaat |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729349 |
gaatatgagtgcgtccggaggatcttgagtttgaactcagaagtaaagcttgcaaagcgaagttatgcaatgaagcctgttccctttgcttgatgtcaat |
44729448 |
T |
|
| Q |
244 |
gaacttgg |
251 |
Q |
| |
|
|||||||| |
|
|
| T |
44729449 |
gaacttgg |
44729456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 44729219 - 44729284
Alignment:
| Q |
15 |
ctttcttaaaggaatatgagtacatcccgagaatcttattagaaatatttgtggagaaataaagac |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729219 |
ctttcttaaaggaatatgagtacatcccgagaatcttattagaaatatttgtggagaaataaagac |
44729284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University