View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17088_low_9 (Length: 241)
Name: NF17088_low_9
Description: NF17088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17088_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 115 - 236
Target Start/End: Original strand, 43580161 - 43580288
Alignment:
| Q |
115 |
aaggtcttctactctagcgcatgtactagcaacgatatcataaagttgcttaaaattttgtcaccggcct------attaagtaccccctttcattgagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43580161 |
aaggtcttctactctagcgcatgtactagcaacgatatcataaagttgcttaaaattttgtcaccggcctcagatgattaagtaccccctttcattgagt |
43580260 |
T |
|
| Q |
209 |
ttgaaaatatcctaatcctctttctgtg |
236 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
43580261 |
ttgtaaatatcctaatcctctttctgtg |
43580288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University