View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17089_low_5 (Length: 250)
Name: NF17089_low_5
Description: NF17089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17089_low_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 6 - 250
Target Start/End: Original strand, 3426409 - 3426653
Alignment:
| Q |
6 |
aggagcagagacatgacaagaaagagtgatcatatccaagtatcaacttcatgttatgcttcaaaaatgtcaacatacatcgaggataagattacatgag |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426409 |
aggaccagacacatgacaagaaagagtgatcatatccaagtatcaacttcgtgttatgcttcaaaaatgtcaacatacatcgaggataagattacatgag |
3426508 |
T |
 |
| Q |
106 |
cttgttggttctaaatattgtgtgttatgtaggtaaacagtttgtaagcaccacatggtcttctctttaaggtaatagacgtattctagatattctgctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426509 |
cttgttggttctaaatattgtgtgttatgtaggtaaacagattgtaagcaccacatggtcttctctttaaggtaatagacgtattctagatattctgctt |
3426608 |
T |
 |
| Q |
206 |
taagtgatcaacaaatcctaagcaccaaacaattattcgtttatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426609 |
taagtgatcaacaaatcctaagcaccaaacaattattcgtttatt |
3426653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University