View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17089_low_9 (Length: 213)
Name: NF17089_low_9
Description: NF17089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17089_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 3714380 - 3714185
Alignment:
| Q |
11 |
gatttgatttgattattaactgttgaaattgtgataatgtgcatgtacatctgtaacaaaatatgaagtatgaaaatcaacatcttactttctagcgtct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3714380 |
gatttgatttgattattaactgttgaaattgtgataatgtgcatgtacatctgtaacaaaatatgaagtatgaaaatcaacatcttactttctagcgtct |
3714281 |
T |
 |
| Q |
111 |
aatttctgacagagacagtgggatatgaagggtgtgtcatgtcatgttacatggaaccttgttgaaatgatatttgtcgcttatgtgaaacctatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3714280 |
aatttctgacagagacagtgggatatgaagggtgtgtcatgtcatgttacatggaaccttgttgaaatgatatttgtcgcttatgtgaaacctatg |
3714185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 164
Target Start/End: Original strand, 17032312 - 17032351
Alignment:
| Q |
125 |
acagtgggatatgaagggtgtgtcatgtcatgttacatgg |
164 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17032312 |
acagtgggttatgaagggtgtgtcttgtcatgttacatgg |
17032351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University