View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1708_high_6 (Length: 229)
Name: NF1708_high_6
Description: NF1708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1708_high_6 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 229
Target Start/End: Original strand, 29525101 - 29525318
Alignment:
| Q |
12 |
aaattattgatgaatcttcaggttctgatccagaggttggtaatacaggtcaaccagatgttgcccatgaaagtcgtgttattattgattcatatctaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525101 |
aaattattgatgaatcttcaggttctgatccagaggttggtaatacagttcaaccagatgttgcccatgaaagtcgtgttattattgattcatatctaga |
29525200 |
T |
|
| Q |
112 |
ttaccaacaagaggtatctagtgaaggtcaagttattgacagttcagttaccataccagaagttgctagttgtggaagtgatcaaggtgtagtagacatt |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525201 |
taaccaacaagaggtatctagtgaaggtcaagttattgacagttcagttaccataccagaagttgctagttgtggaagtgatcaaggtgtagtagacatt |
29525300 |
T |
|
| Q |
212 |
atacttgaagaaaattca |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29525301 |
atacttgaagaaaattca |
29525318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 12 - 148
Target Start/End: Original strand, 29612890 - 29613035
Alignment:
| Q |
12 |
aaattattgatgaatcttcaggttctgatccagaggttggtaatacaggtcaacca------gatgttgcccatgaa---agtcgtgttattattgattc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| | | ||| |||| ||||||||||| || |
|
|
| T |
29612890 |
aaattattgatgaatcttcaggttctgatccagaggttggtaatgtaggtcaaccagatgttgatgttggcaacgaaattagtcaagttattattgagtc |
29612989 |
T |
|
| Q |
103 |
atatctagattaccaacaagaggtatctagtgaaggtcaagttatt |
148 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
29612990 |
atatccagattgccaaaaagaggtatctagtgaaggtcaagatatt |
29613035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University