View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1708_low_2 (Length: 301)
Name: NF1708_low_2
Description: NF1708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1708_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 11953533 - 11953736
Alignment:
| Q |
11 |
ttatgatttacgctggtcttatatgcttgttctgttcgtgtctatatggtagagagtatataaatattatttataatcttttcatagattataataatag |
110 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11953533 |
ttattatttacgttggtcttatatgcttgttctgttcgtgtctatatggtagagagtatataaatattatttataatcttttcatagatgataataatag |
11953632 |
T |
 |
| Q |
111 |
tttgacattgatgttaacacttttgtggccttacaatggcagcagtaaattctggaggttttagtttggtggaggctctatccactaagaagtcttaaat |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11953633 |
tttgacattgattttaacacttttgtggcctttcaatggcagcagtaaattctggaggttttagtttggtggaggctctatccactaagaagtcttaaat |
11953732 |
T |
 |
| Q |
211 |
agat |
214 |
Q |
| |
|
|||| |
|
|
| T |
11953733 |
agat |
11953736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University