View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-33 (Length: 349)
Name: NF1709-Insertion-33
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-33 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 8 - 349
Target Start/End: Complemental strand, 35170296 - 35169955
Alignment:
| Q |
8 |
tgaacatgcttattctgggcaccaacaagagcatcaaaaattggactagacaataacacaaacaccttatcttcattaccttgattcgctagtttcaaag |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35170296 |
tgaacatgcttattctgttcaccaacaagagcgtcaaaaattggactagacaataacacaaacaccttatcttcattaccttgattcgctaatttcaaag |
35170197 |
T |
 |
| Q |
108 |
ctaaaacagagaaaatttcaatacaaccttctctaacagaagaatctggatctctaaaacatttaacaacagaggcaacaattttggtgagatgtgggag |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170196 |
ctaaaacagagaaaatttcaacacaaccttctctaacagaagaatctggatctctaaaacatttaacaacagaggcaacaattttggtgagatgtgggag |
35170097 |
T |
 |
| Q |
208 |
tataagagattcataaactgtggcgagtgaggcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170096 |
tataagagattcataaactgtggcgagtgaagcgatgagtttgagagattgttttctgatggaaggttttagttcggagtgaatgtcgagaatgcaagag |
35169997 |
T |
 |
| Q |
308 |
aggaatggggagatggaatgtggagttaatgagtggaggatt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35169996 |
aggaatggggagatggaatgtggagttaatgagtggaggatt |
35169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University