View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-43 (Length: 138)
Name: NF1709-Insertion-43
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-43 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 6e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 4314060 - 4313930
Alignment:
| Q |
8 |
gatttggccacattgcttggtggagaattctattacagagtagaagaactcagaaatgaaacaaatattggtaccaagactcgacatttatcatttacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4314060 |
gatttggccacattgcttggtggagaattctattacagagtagaagaactcggaaatgaaacaaatattggtaccaagactcgacatttatcatttacca |
4313961 |
T |
|
| Q |
108 |
cgttcattgatccaatcttgggaaactatga |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4313960 |
cgttcattgatccaatcttgggaaactatga |
4313930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 128
Target Start/End: Original strand, 4254426 - 4254546
Alignment:
| Q |
8 |
gatttggccacattgcttggtggagaattctattacagagtagaagaactcagaaatgaaacaaatattggtaccaagactcgacatttatcatttacca |
107 |
Q |
| |
|
||||| || ||||| |||| |||||||||||||| |||| | |||| || | || ||||| || |||||||| || ||||| ||||||||||||| |
|
|
| T |
4254426 |
gatttagcaacatttcttgatggagaattctatttcagaacataagagcttgggaaagaaactaagattggtactaacactcgtcatttatcatttagtg |
4254525 |
T |
|
| Q |
108 |
cgttcattgatccaatcttgg |
128 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
4254526 |
agttcagtgatccaatcttgg |
4254546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 9e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 41933869 - 41933995
Alignment:
| Q |
8 |
gatttggccacattgcttggtggagaattctattacagagtagaagaactcagaaatgaaacaaatattggtaccaagactcgacatttatcatttacca |
107 |
Q |
| |
|
||||| ||||| ||||| ||||| ||||||||||||||| ||||||||| ||||||||||||| ||| ||||||||||||| ||||||||||||| || |
|
|
| T |
41933869 |
gatttagccacgttgctcggtggggaattctattacagaacagaagaacttggaaatgaaacaaagattagtaccaagactcgtcatttatcatttagca |
41933968 |
T |
|
| Q |
108 |
cgttcattgatccaatcttgggaaact |
134 |
Q |
| |
|
| |||| ||||||||||| || ||||| |
|
|
| T |
41933969 |
cattcactgatccaatctcggaaaact |
41933995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University