View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-46 (Length: 70)
Name: NF1709-Insertion-46
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-46 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 6 - 70
Target Start/End: Original strand, 15748898 - 15748962
Alignment:
| Q |
6 |
actacctacctttaataagggtgaattggttttctataataattttatccatcacatgtgtcagg |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15748898 |
actacctacctttaataagggagaattggttttctataataattttatccatcacatgtgtcagg |
15748962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University