View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-47 (Length: 66)
Name: NF1709-Insertion-47
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-47 |
 | |
|
| [»] scaffold2079 (1 HSPs) |
| |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: scaffold2079 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: scaffold2079
Description:
Target: scaffold2079; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 1045 - 1103
Alignment:
| Q |
8 |
gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1045 |
gttgtttcaattttagcattgatggttatttcgccgacaattgcttggatttatttggg |
1103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 3e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 6325843 - 6325785
Alignment:
| Q |
8 |
gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg |
66 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
6325843 |
gttgtttcaattttagctttaatggttatttcgccgacaattgcatggatttatttggg |
6325785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 6333320 - 6333262
Alignment:
| Q |
8 |
gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg |
66 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||| || || |||||||||||||||||||| |
|
|
| T |
6333320 |
gttgtttcagttttagctttgatgataatttctcctacaattgcttggatttatttggg |
6333262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 66
Target Start/End: Original strand, 6242854 - 6242885
Alignment:
| Q |
35 |
atttcgccgactattgcttggatttatttggg |
66 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
6242854 |
atttcgccgacaattgcttggatttatttggg |
6242885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University