View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-49 (Length: 427)
Name: NF1709-Insertion-49
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 8 - 294
Target Start/End: Original strand, 21830839 - 21831125
Alignment:
| Q |
8 |
ccggcttccggtgtttggcagggtgaaatgaggagactgcagaggcaaaggataaccggctattttcataatcatcatcttcatcagaagaagaagctaa |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830839 |
ccggcttccggtgtttggaagggtgaaaggaggagactgcagaggcaaaggataaccggctatcttcataatcatcatcttcatcagaagaagaagctaa |
21830938 |
T |
 |
| Q |
108 |
gtcatcggggacggcggtggagagacggttatatgtttcaaagaaatgtaagtcgtcctcgtcgtcgccgaggccgtcccaattcatggtcagcgtcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21830939 |
gtcatcggggacggcggtggagagacggttatatgtttcaaagaaatgtaagtcgtcctcgtcgtcgccgaggccgtcccaattcatggtcagcgttttt |
21831038 |
T |
 |
| Q |
208 |
cggcgttccatggtggccatcggcggcaggaggttttggaaatggaatggaatacgctatgacaaatatgaaatgtaatggaaaacg |
294 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21831039 |
ctgcgttccatggtggccatcggcggcaggaggttttggaaatggaatggaaaacgctatgacaaatatgaaatgtaatggaaaacg |
21831125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University