View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709-Insertion-52 (Length: 243)
Name: NF1709-Insertion-52
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709-Insertion-52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 47537190 - 47536956
Alignment:
| Q |
9 |
gaaaatcgacatccctaatagcgttttgagatgctagacattgtgtacttatgcttgcggtcatggaacagcctcaatacaactgctgcagtttcttcta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47537190 |
gaaaatcgacatccctaatagcgttttgagatgctagacattgtgtacttatgcttgcggtcatggaacagcctcaatacaactgctgcagtttcttcta |
47537091 |
T |
 |
| Q |
109 |
tcgctttagcagtcacatctgtatatattagtgaaaaaatttagaatccatcagcattagtttgaatgtaatattttgcaacaccctttgaactaatcag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47537090 |
tcgctttagcagtcacatctgtatatattagtgaaaaaatttagaatccatcagcattagtttgaatgtaatattttgcaacaccctttgaactaatcaa |
47536991 |
T |
 |
| Q |
209 |
aatcacagtttgaataataaaaatttgaaatcgag |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47536990 |
aatcacagtttgaataataaaaatttgaaatcgag |
47536956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University