View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17091_high_11 (Length: 229)
Name: NF17091_high_11
Description: NF17091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17091_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 216
Target Start/End: Original strand, 40878480 - 40878692
Alignment:
| Q |
4 |
gtagataatactgattaaattgcttacatttagcgagcctggcgattttctgagaggtttcatggattcctaatccgatttgtgatgcttttcggttgaa |
103 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878480 |
gtagattataatgattaaattgcttacatttagcgagcctggcgattttctgagaggtttcatggattcctaatccgatttgtgatgcttttcggttgaa |
40878579 |
T |
 |
| Q |
104 |
atcggatcttgaataggaactttgagaggtagacggttgttgattcggcggtgcagtggctccgcctcctccgccgccgattttcttgagagtctccgtc |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878580 |
atcggatcttgaataggaaatttgagaggtagacggttgttgattcggcggtgcagtggctccgcctcctccgccgccgattttcttgagagtctccgtc |
40878679 |
T |
 |
| Q |
204 |
agtgatcgaaact |
216 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40878680 |
agtgatcgaaact |
40878692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University