View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17091_low_11 (Length: 237)
Name: NF17091_low_11
Description: NF17091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17091_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 3743986 - 3743785
Alignment:
| Q |
20 |
ctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3743986 |
ctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattc |
3743887 |
T |
|
| Q |
120 |
tcggtcgtcacaatgacaccataaccggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattacta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3743886 |
tcggtcgtcacaatgacaccataaccggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattacta |
3743787 |
T |
|
| Q |
220 |
tt |
221 |
Q |
| |
|
|| |
|
|
| T |
3743786 |
tt |
3743785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University