View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17091_low_11 (Length: 237)

Name: NF17091_low_11
Description: NF17091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17091_low_11
NF17091_low_11
[»] chr5 (1 HSPs)
chr5 (20-221)||(3743785-3743986)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 3743986 - 3743785
Alignment:
20 ctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3743986 ctctctactctctcacctcatttgggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattc 3743887  T
120 tcggtcgtcacaatgacaccataaccggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattacta 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3743886 tcggtcgtcacaatgacaccataaccggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattacta 3743787  T
220 tt 221  Q
    ||    
3743786 tt 3743785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University