View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17091_low_5 (Length: 376)
Name: NF17091_low_5
Description: NF17091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17091_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 9 - 217
Target Start/End: Complemental strand, 3270277 - 3270073
Alignment:
| Q |
9 |
caagaatatagtcatttctttttgaaaataaaccatttgatcactcaagcatcacatttatggtaatcttggttttaattcaagtttgtaaccttnnnnn |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3270277 |
caagaaaatagtcatttctttttgaaaataaactattggatcactcaagtatcacatttatgctaatcttggttttaattcaagtttgtaaccttaaaaa |
3270178 |
T |
|
| Q |
109 |
nnnnnnncaatggnnnnnnngtttgtttcaaaagtgatgatttttgccacaaaattggtatttcctattcataatcagaattgaaattataattatcact |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3270177 |
taaata-caatggtttttttgtttgtttcaaaagtgatgatttttgccacaaaattggtatttcctattcataatcagaattgaa---ataattatcact |
3270082 |
T |
|
| Q |
209 |
tctaagacc |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
3270081 |
tctaagacc |
3270073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 249 - 355
Target Start/End: Complemental strand, 3270041 - 3269935
Alignment:
| Q |
249 |
gtttcgaaacaaaattacaataagtatgatattttaaggacaaaaaagtttgatcttaaaaagagcgagactattttttaaagcatgataaattatagag |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3270041 |
gtttcgaaacaaaattacaataagtatgatattttaaggacaaaaaagtttgatcttaaaaagagcgagactattttttaaagcatgataaattatagag |
3269942 |
T |
|
| Q |
349 |
ggacttt |
355 |
Q |
| |
|
||||||| |
|
|
| T |
3269941 |
ggacttt |
3269935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University