View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17092_high_33 (Length: 317)
Name: NF17092_high_33
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17092_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 82 - 300
Target Start/End: Original strand, 23924435 - 23924655
Alignment:
| Q |
82 |
tatcaaaattgaagaccacaattatataatagagtgcgtaaaaactatcaaaatttccataactgctttgaaatttgcat--tagaattaagattcattt |
179 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
23924435 |
tatcaaaatagaagaccacaattatataatagagtgcgtaaaaactatcaaaatttccataactgctttgaaatttgcatgttataattaagattcattt |
23924534 |
T |
 |
| Q |
180 |
aattttttctttaagttaatgtatgagagatgtattgcagatactcatcagcttctgagcacacaaatgatactgattttttcgtgaccatagtggatcc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23924535 |
aattttttctttaagttaatgtatgagagatgtattgcagatactcataaccttctgagcacacaaatgatactgattttttcgtgaccatagtggatcc |
23924634 |
T |
 |
| Q |
280 |
aaaacaggtagccaccaattt |
300 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23924635 |
aaaacaggtagccaccaattt |
23924655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 23923435 - 23923492
Alignment:
| Q |
5 |
gaggagcagcacagagaagaacacacaaaatcatctacctgaataagttttgtttcct |
62 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23923435 |
gaggagccccacaaagaagaacacacaaaatcatctacctgaataagttttgtttcct |
23923492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 24923891 - 24923851
Alignment:
| Q |
20 |
gaagaacacacaaaatcatctacctgaataagttttgtttc |
60 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
24923891 |
gaagaacacacaaaatcatctaactgcataagtttagtttc |
24923851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University