View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17092_high_42 (Length: 263)
Name: NF17092_high_42
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17092_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 81 - 248
Target Start/End: Original strand, 4676332 - 4676499
Alignment:
| Q |
81 |
ctcccccatttttaaagaaaaaactactgataacatttagaatatagatttacctggtttcgggcactggtcttattgaagggagatcgtggatcttcag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4676332 |
ctcccccatttttaaagaaaaaactactgataacatttagaatatagatttacctggtttcgggcactggtcttactgaagggagatcgtggatcttcag |
4676431 |
T |
 |
| Q |
181 |
aagtataaatggagtaccaaccttgatgcactttaggatcattaatattattgctattaccaaatact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676432 |
aagtataaatggagtaccaaccttgatgcactttaggatcattaatattattgctattaccaaatact |
4676499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University