View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17092_high_43 (Length: 251)
Name: NF17092_high_43
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17092_high_43 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 4675837 - 4676078
Alignment:
| Q |
10 |
attattctctaacagttaaactaactaagactataacaattatatccttcaaaaaagacttttaacaattattttatttgagggcctttttccttgaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4675837 |
attattctctaacagttaaactaactaagactataacaattatatccttcaaaaaagactattaacaattattttatttgagggcctttttccttgaaaa |
4675936 |
T |
 |
| Q |
110 |
aatatatgttttattggagatctaaagcaagggtttggtccgcttcacccttgggtccgtgtaatacacaaaccatattannnnnnnaagggaaaaacca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4675937 |
aatatatgttttattggagatctaaagcaagggtttggtccgcttcatccttgggtccgtgtaatacacaaaccatattgtttttttaagggaaaaacca |
4676036 |
T |
 |
| Q |
210 |
taatgattttattagttaaaatatggatcatatacgggaaaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
4676037 |
taatgattttagtagttaaaatatggataatatacggaaaaa |
4676078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University