View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17092_high_48 (Length: 231)
Name: NF17092_high_48
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17092_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 3423785 - 3423650
Alignment:
| Q |
84 |
ccctatcgtcattttaagttaaccaaccgtcaaagattaaatctagctctaagaatactccaatgttttca--ctctataaaaagttttaccgaatataa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| ||| |||||||||| ||||| |
|
|
| T |
3423785 |
ccctatcgtcattttaagttaaccaaccgtcaaagattgaatctagctctaagaatactccattgttttcactctctatgaaatgttttaccgattataa |
3423686 |
T |
 |
| Q |
182 |
agttctatccaacatgagatattagtctttgtaattg |
218 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
3423685 |
agttctatcc-acacaagatattaatctttgtaattg |
3423650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University