View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17092_low_53 (Length: 205)
Name: NF17092_low_53
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17092_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 5337625 - 5337447
Alignment:
| Q |
9 |
tgtcgaagaaaatcttcgtgtacttgcatatgagtatgctactatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337625 |
tgtcgaagaaaatcttcgtgtacttgcatatgagtatgctattatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaatt |
5337526 |
T |
 |
| Q |
109 |
atacttcatataagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaacc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337525 |
atacttcatataagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaacc |
5337447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 13 - 187
Target Start/End: Original strand, 52717407 - 52717581
Alignment:
| Q |
13 |
gaagaaaatcttcgtgtacttgcatatgagtatgctactatgggctctcttcatgacattttgcacggtatgtagcatcatatccattcttaaattatac |
112 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | ||| | |
|
|
| T |
52717407 |
gaaggaaatctccgtgtacttgcatatgagtttgctactatgggctctcttcatgacattttgcacggtatgtagcttcatatcctttctttacttaaat |
52717506 |
T |
 |
| Q |
113 |
ttcatataagaagttccgttgatgattttgatgtctttccattacaggtaaaaatggagttcaaggggcgcaacc |
187 |
Q |
| |
|
|| |||||||||||||| |||||||||||| | |||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
52717507 |
tttatataagaagttccattgatgattttggcgactttccattacaggtagaaagggagttcaaggggcacaacc |
52717581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University