View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_high_12 (Length: 477)
Name: NF17093_high_12
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 14 - 470
Target Start/End: Original strand, 52334486 - 52334942
Alignment:
| Q |
14 |
atatgatacactaattcctaggtacccgggtgttacagaagcctggcaactctcctcacaactgcttccaaaatacctgctaacccccagttcctatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52334486 |
atatgatacactaattcctaggtacccgggtgttacagaagcctggcaactctcctcacaactgcttccaaaatacctgctaacccccagttcctatttt |
52334585 |
T |
 |
| Q |
114 |
cccacttttttgtaactaccactgtatgttactctgttacagtaactattgccctgaaaactttaatcccatattgtactgcttactttttctaatgtaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
52334586 |
cccacttttttgtaactaccactgtatgttactctgttacagtaactattgccctgaaaactttaatcccgtattgtactggttactttttctaatgtaa |
52334685 |
T |
 |
| Q |
214 |
aacttctgcattggagctctactgtcaccgtgacatcatctttcgcaggaagtttatccataagtcctctagttagttagtgggtgaggatgtgatgtaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52334686 |
aacttctgcattggagctctactgtcaccgtgacatcatctttcacaggaagtttatccataagtcctttagttagttagtgggtgaggatgtgatgtaa |
52334785 |
T |
 |
| Q |
314 |
tataataaattggaagaattgggaaatagaagggtgtgatggatgtctgtgagtttggaagtgttggggcgctcacaaagcagcatggatttcggcattc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52334786 |
tataataaattggaagaattgggaaatagaagggtgtgatggatgtctgtgagtttggaagtgttggggcgctcacaaagcagcatggatttcggcattc |
52334885 |
T |
 |
| Q |
414 |
tttccctctgatcacattgatccagggaataattcatgatacaagtctccttctctg |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52334886 |
tttccctctgatcacattgatccagggaataattcatgatacaagtctccttttctg |
52334942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University