View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_high_29 (Length: 264)
Name: NF17093_high_29
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 42981241 - 42981124
Alignment:
| Q |
9 |
gagatgaaaattaggagaacgaaagaattactacatgtgatatgaggagaaataaagataaatgggataaatgatggaaaaagatacgtgagcataaaat |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42981241 |
gagatgtaaattaggagaacgaaagaattactacatgtgatatgaggagaaataaagataaatgggataaatgatggaaaaagatacgtgagcataaaat |
42981142 |
T |
|
| Q |
109 |
acgatgatatttacccta |
126 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42981141 |
acgatgatatttacccta |
42981124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 179 - 249
Target Start/End: Complemental strand, 42981121 - 42981051
Alignment:
| Q |
179 |
ggacaatcgcttccaatttttcatgatggtaagtttgaaacattcagttcaggtactttttatattcaatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42981121 |
ggacaatcgcttccaatttttcatgatggtaagtttgaaacattcagttcaggtactttttatattcaatt |
42981051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University