View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_high_35 (Length: 245)
Name: NF17093_high_35
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 46 - 231
Target Start/End: Original strand, 24424847 - 24425027
Alignment:
| Q |
46 |
gtagttcctctcctcgctataattttgaatttgttggtgatgagatgatgcagggagttgtattatctgattctgatgacacggatgatggggaaggtgt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24424847 |
gtagttcctctcctcgctataattttgaatttgttggtgatg-----atgcagggagttgtattatctgattctgatgacacggatgatggggaaggtgt |
24424941 |
T |
 |
| Q |
146 |
attctttgattcctcagattggttatctggagagtgactcgaaaaatgtaagaacaattttcatcatgcttatcaatatcatatat |
231 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24424942 |
attctttgattcctcagattagttatctggagagtgactcgaaaaatgtaagaacaattttcatcatgcttatcaatatcatatat |
24425027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 24424602 - 24424647
Alignment:
| Q |
1 |
ataatactgtcattgtgaacaatgaagttgaataatgtgatctttg |
46 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24424602 |
ataatattgtcattatgaacaatgaagttgaataatgtgatctttg |
24424647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University