View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_high_40 (Length: 219)
Name: NF17093_high_40
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_high_40 |
 |  |
|
| [»] scaffold0635 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0635 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0635
Description:
Target: scaffold0635; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 5 - 207
Target Start/End: Original strand, 2232 - 2430
Alignment:
| Q |
5 |
ccggagcccaatcaacttggttttctagaaagtaactttatgctagaaattaatttatcggttatttctttaaaatacgaccttgatattaatgacttag |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2232 |
ccggagcccaattaacttggttttctagaaagtaactttatgctagaaatt----tatcggttatttctttaaaatacgaccttgatattaatgacttag |
2327 |
T |
 |
| Q |
105 |
cgtgtttggtacatgcaagacttgacttatgttgcgtttgttcccaagtttgatcacatataaattggataacacaagttaagtttcttaagaatttcat |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2328 |
cgtgtttgttacatgcaagacttgacttatgttgcgtttgttcccaagtttgatcacatataaattggataacacaagttaagtttctcaagaatttcat |
2427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 10106552 - 10106354
Alignment:
| Q |
5 |
ccggagcccaatcaacttggttttctagaaagtaactttatgctagaaattaatttatcggttatttctttaaaatacgaccttgatattaatgacttag |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10106552 |
ccggagcccaattaacttggttttctagaaagtaactttatgctagaaatt----tatcggttatttctttaaaatacgaccttgatattaatgacttag |
10106457 |
T |
 |
| Q |
105 |
cgtgtttggtacatgcaagacttgacttatgttgcgtttgttcccaagtttgatcacatataaattggataacacaagttaagtttcttaagaatttcat |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10106456 |
cgtgtttgttacatgcaagacttgacttatgttgcgtttgttcccaagtttgatcacatataaattggataacacaagttaagtttctcaagaatttcat |
10106357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University