View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_low_21 (Length: 346)
Name: NF17093_low_21
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 24 - 271
Target Start/End: Original strand, 29092565 - 29092806
Alignment:
| Q |
24 |
tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagttttatcttgccctttcaacttcaagtgacaatttttctcttagttgc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29092565 |
tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagtattatcttgccctttca------agtgacaatttttctcttagttgc |
29092658 |
T |
 |
| Q |
124 |
cacaatctctatgttagtaccaaagacatgggcactaaaatgaagtaatgccagcaaagaatcacaaatttttcttgtaaagttagagagaaataacatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092659 |
cacaatctctatgttagtaccaaagacatgggcactgatatgaagtaatgccagcaaagaatcacaaatttttcttgtaaagttagagagaaataacatg |
29092758 |
T |
 |
| Q |
224 |
gtaatgagaagcactgatcatgagagcagatcaagaaccaatgacttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092759 |
gtaatgagaagcactgatcatgagagcagatcaagaaccaatgacttg |
29092806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University