View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_low_29 (Length: 266)
Name: NF17093_low_29
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 24 - 257
Target Start/End: Original strand, 50592394 - 50592630
Alignment:
| Q |
24 |
acacgatcatgaaacagatcacattggttttaatgccagttttatcaaattggtctgtcagaaagaaatcataatcacactgtccctcactgccttgtgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50592394 |
acacgatcatgaaacagatcacattggttttaatggcagttttatcaaattggtctgtcagaaagaaatcataatcacactgtccctcactgccttgtgt |
50592493 |
T |
 |
| Q |
124 |
ttttcttgtcatttgtttggttttgcatgttagcctcacaaatgtttttgtttctaaatgc---tagactcacacgtatactaaaccagcggtctgtgca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50592494 |
ttttcttgtcatttgtttggttttgcatgttagcctcacaaatgtttttgtttctaaatgctagtagactcacacgtatactaaaccagcggtctgtgca |
50592593 |
T |
 |
| Q |
221 |
tgcgagtttactgttacagctatttagtgatctgtgc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50592594 |
tgcgagtttactgttacagctatttagtgatctgtgc |
50592630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University