View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17093_low_37 (Length: 244)
Name: NF17093_low_37
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17093_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 3986401 - 3986631
Alignment:
| Q |
1 |
ctgtgacaggccttttgttgtcgatattcaaacaatggataagatcaatccctcgatttctcttatcacacttcatcatatcttattttatttgtcactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3986401 |
ctgtgacaggccttttgttgtcgatattcaaacaatggataagatcaatccctcgatttctcttatcacgcttcatcatatcttattttatttgtcactt |
3986500 |
T |
 |
| Q |
101 |
agaagagaacttggtgttggtggtccccaaaacttattcaattatttgcaagtattattattaatcaggatgattaggacatccattaatt-----tagg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3986501 |
agaagagaacttggtgttggtggtccccaaaacttattcaattatttccaagtattattattaatcaggatgattaggacatccattaatttagtgtagg |
3986600 |
T |
 |
| Q |
196 |
atgtaagcatcgcagttgaattattatgata |
226 |
Q |
| |
|
||||||||||||||| |||||||||| |||| |
|
|
| T |
3986601 |
atgtaagcatcgcagctgaattattacgata |
3986631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University